Quick Order

DatasheetReviewsRelated ProductsProtocols
Human TIMP1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

TIMP metallopeptidase inhibitor 1, also known as TIMP-1/TIMP1, Collagenase inhibitor 16C8 fibroblast Erythroid-potentiating activity, TPA-S1TPA-induced proteinTissue inhibitor of metalloproteinases 1, is a natural inhibitors of the matrix metalloproteinases (MMPs), a group of peptidases involved in degradation of the extracellular matrix. TIMP-1/TIMP1 is found in fetal and adult tissues. Highest levels are found in bone, lung, ovary and uterus. Complexes with metalloproteinases and irreversibly inactivates them by binding to their catalytic zinc cofactor. TIMP-1/TIMP1 mediates erythropoiesis in vitro; but, unlike IL-3, it is species-specific, stimulating the growth and differentiation of only human and murine erythroid progenitors. In addition to its inhibitory role against most of the known MMPs, the protein is able to promote cell proliferation in a wide range of cell types, and may also have an anti-apoptotic function. Transcription of this protein encoding gene is highly inducible in response to many cytokines and hormones. In addition, the expression from some but not all inactive X chromosomes suggests that this gene inactivation is polymorphic in human females. This encoding gene is located within intron 6 of the synapsin I gene and is transcribed in the opposite direction. Complexes with metalloproteinases and irreversibly inactivates them by binding to their catalytic zinc cofactor. TIMP-1/TIMP1 is Known to act on MMP-1, MMP-2, MMP-3, MMP-7, MMP-8, MMP-9, MMP-10, MMP-11, MMP-12, MMP-13 and MMP-16.

References
  • Hornebeck W (2004). Down-regulation of tissue inhibitor of matrix metalloprotease-1 (TIMP-1) in aged human skin contributes to matrix degradation and impaired cell growth and survival.. Pathol. Biol. 51 (10): 569-73.
  • Soini Y, et al. (2001) Expression of MMP2, MMP9, MT1-MMP, TIMP-1, and TIMP2 mRNA in valvular lesions of the heart. J Pathol. 194(2):225-31.
  • Wang X, et al. (1999) Analysis of coding sequences for tissue inhibitor of metalloproteinases 1 (TIMP-1) and 2 (TIMP2) in patients with aneurysms. Matrix Biol. 18(2):121-4.
  • Images
        Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"