After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse PCNA Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PCNAcDNA Clone Product Information
cDNA Size:786
cDNA Description:ORF Clone of Mus musculus proliferating cell nuclear antigen DNA.
Gene Synonym:Pcna
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Proliferating Cell Nuclear Antigen (PCNA) is a protein only expresse in nomal proliferate cells and cancer cells. It is central to both DNA replication and repair. One of the well-established functions for PCNA is its role as the processivity factor for DNA polymerase delta and epsilon. PCNA tethers the polymerase catalytic unit to the DNA template for rapid and processive DNA synthesis. Two forms of PCNA exist in cells: (i) a detergent-insoluble trimeric form stably associated with the replicating forks during S phase and (ii) a soluble form in quiescent cells in G1 and G2 phases. PCNA forms a toroidal trimer in S phase with replication factor-C (RF-C) and DNA in an ATP-dependent manner and enables the loading of DNA polymerase delta and epsilon onto the complex. The close association of PCNA with kinase complexes involved in cell cycle machinery indicates that PCNA has a regulatory role in cell cycle progression. PCNA also participates in the processing of branched intermediates that arise during the lagging strand DNA synthesis.

  • Balajee AS, et al. (2001) Chromatin-bound PCNA complex formation triggered by DNA damage occurs independent of the ATM gene product in human cells. Nucleic Acids Res. 29 (6): 1341-51.
  • Ducoux M, et al. (2001) Mediation of proliferating cell nuclear antigen (PCNA)-dependent DNA replication through a conserved p21(Cip1)-like PCNA-binding motif present in the third subunit of human DNA polymerase delta. J Biol Chem. 276 (52): 49258-66.
  • Tetsuo I, et al. (2002) PCNA clamp facilitates action of DNA cytosine methyltransferase 1 on hemimethylated DNA. Genes Cells. 7(10): 997-1007.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items