Quick Order

DatasheetReviewsRelated ProductsProtocols
Human TDGF1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Human TGFB1 (LAP) / TGF-beta 1 Protein (His Tag)Canine TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGFB2 / TGF-beta 2 Protein (His Tag)Mouse TGF-beta 2 / TGFB2 Protein (His Tag)Mouse ALK-4 / ACVR1B Protein (Fc Tag)Human ALK-7 / ACVR1C Protein (ECD, Fc Tag)Mouse Latent TGF-beta 1 / TGFB1 Protein (His Tag)Mouse BAMBI / NMA Protein (His Tag)Rat / Mouse TGF-beta 1 / TGFB1 ProteinHuman ALK-2 / ACVR1 Protein (His & Fc Tag)Human Decorin / DCN / SLRR1B Protein (Fc Tag)Human Endoglin / CD105 / ENG Protein (Fc Tag)Human TGFBR2 Protein (His & Fc Tag)Mouse ALK-2 / ACVR1 Protein (His & Fc Tag)Human Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human ALK4 / ACVR1B Protein (His Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (His & Fc Tag)Human Endoglin / CD105 / ENG Protein (His Tag)Human Cripto / TDGF1 Protein (His Tag)Human BAMBI / NMA Protein (His Tag)Human Decorin / DCN / SLRR1B Protein (His Tag)Mouse Endoglin / CD105 / ENG Protein (His Tag)Human ALK4 / ACVR1B Protein (His & Fc Tag)Mouse TGFBR3 / Betaglycan Protein (His Tag)Human ATF2 Protein (His & GST Tag)Human ALK-2 / ACVR1 / ALK2 Protein (His Tag)Human / Rhesus / Canine TGF-beta 1 / TGFB1 ProteinRat Cripto / TDGF1 Protein (Fc Tag)Rat TGFBR2 Protein (Fc Tag)Rhesus ACVR1B / ALK-4 Protein (Fc Tag)Mouse BAMBI / NMA Protein (Fc Tag)Rat ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Rhesus TGFBR2 Protein (Fc Tag)Rhesus ALK-7 / ALK7 / ACVR1C Protein (Fc Tag)Cynomolgus ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (aa 200-503, His & GST Tag)Mouse Smad2 Protein (His & GST Tag)Mouse Smad5 Protein (His & GST Tag)Rat ACVR1B / ALK-4 Protein (Fc Tag)Mouse Smad3 Protein (His & GST Tag)Mouse Smad5 ProteinHuman TGFBR3 / Betaglycan Protein (His Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)Rat Cripto / TDGF1 Protein (His Tag)Rat Latent TGF-beta 1 / TGFB1 Protein (His Tag)Cynomolgus TGF-beta 1 / TGFB1 Protein (His Tag)

Cripto/TDGF1 is a member of the epidermal growth factor (EGF)- Cripto, Frl-1, and Cryptic (CFC) family. EGF-CFC family member proteins share a variant EGF-like motif, a conserved cysteine-rich domain, and a C-terminal hydrophobic region. Before gastrulation, Cripto is asymmetrically expressed in a proximal–distal gradient in the epiblast, and subsequently is expressed in the primitive streak and newly formed embryonic mesoderm. These proteins play key roles in intercellular signaling pathways during vertebrate embryogenesis. Mutations in Cripto/TDGF1 can cause autosomal visceral heterotaxy. Cripto/TDGF1 is involved in left-right asymmetric morphogenesis during organ development. Cripto signalling is essential for the conversion of a proximal–distal asymmetry into an orthogonal anterior–posterior axis. The mechanism of inhibitory effects of the Cripto includes both cancer cell apoptosis, activation of c-Jun-NH(2)-terminal kinase and p38 kinase signaling pathways and blocking of Akt phosphorylation. Thus, Cripto is a unique target, and Immunohistochemistry to Cripto could be of therapeutic value for human cancers.

  • Calvanese L, et al. (2006) Solution structure of mouse Cripto CFC domain and its inactive variant Trp107Ala. J Med Chem. 49 (24): 7054-62.
  • Lonardo E, et al. (2010) A small synthetic cripto blocking Peptide improves neural induction, dopaminergic differentiation, and functional integration of mouse embryonic stem cells in a rat model of Parkinson's disease. Stem Cells. 28 (8): 1326-37.
  • Chambery A, et al. (2009) Qualitative and quantitative proteomic profiling of cripto(-/-) embryonic stem cells by means of accurate mass LC-MS analysis. J Proteome Res. 8 (2): 1047-58.
  • Images
        Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.