Quick Order

Text Size:AAA

Human GPR114 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GPR114 cDNA Clone Product Information
RefSeq ORF Size:1587bp
cDNA Description:Full length Clone DNA of Homo sapiens G protein-coupled receptor 114.
Gene Synonym:PGR27, GPR114
Restriction Site:KpnI + XhoI (5.5kb + 1.59kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

GPR114 belongs to the G-protein coupled receptor 2 family. Members of this family share a common molecular architecture which consists of seven transmembrane domains, three extracellular loops, three intracellular loops, an amino-terminal extracellular domain and an intracellular carboxyl terminus. It is thought that light acts as the activating stimulus of a G-protein-coupled receptor (GPCR). GPCRs are expected to have molecular function (G-protein coupled receptor activity) and to localize in various compartments (endoplasmic reticulum membrane, plasma membrane, integral to membrane). Family B of the GPCRs is a small but structurally and functionally diverse group of proteins that includes receptors for polypeptide hormones, molecules thought to mediate intercellular interactions at the plasma membrane and a group of Drosophila proteins that regulate stress responses and longevity. GPR114 contains 1 GPS domain. GPR114 gene has been proposed to participate in processes (G-protein coupled receptor protein signaling pathway, neuropeptide signaling pathway).

  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Bjarnadttir TK, et al. (2005) The human and mouse repertoire of the adhesion family of G-protein-coupled receptors. Genomics. 84(1):23-33.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC) . Genome Res. 14(10B):2121-7.
  • Size / Price
    Catalog: HG10854-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions