Quick Order

Human Soggy-1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DKKL1 cDNA Clone Product Information
RefSeq ORF Size:729bp
cDNA Description:Full length Clone DNA of Homo sapiens dickkopf-like 1 (soggy).
Gene Synonym:SGY, SGY1, SGY-1, DKKL1
Restriction Site:HindIII + XhoI (5.5kb + 0.73kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Dickkopf-like 1 (DKKL1) or soggy 1, is a glycoprotein unique to mammals that is expressed primarily in developing spermatocytes and localized in the acrosome of mature sperm. It is also expressed in the trophectoderm / placental lineage. This glycoprotein is secreted by postmeiotic male germ cells. DKKL1 is a member of the Dickkopf (DKK) family, a group of proteins that are characterized as secreted antagonists of Wnt signal transduction proteins. In mammals, embryos lacking DKKL1 protein developed into viable, fertile adults. DKKL1, either directly or indirectly, facilitates the ability of sperm to penetrate the zona pellucid. DKKL1 is related to the sperm apoptotic procession. Molecular analyses identified the Fas death ligand (FasL) as a target for DkkL1 pro-apoptotic activity in adult mice. DKKL1 is considered as a negative regulator of adult testic homeostasis and identifies a novel, DKKL1 / FasL- dependent, regulation that specifically controls the number of postpubertal spermatocytes. 

  • Niehrs C. (2006) Function and biological roles of the Dickkopf family of Wnt modulators. Oncogene. 25 (57): 7469-81.
  • Kohn MJ, et al. (2010) The Acrosomal Protein Dickkopf-Like 1 (DKKL1) Facilitates Sperm Penetration Of The Zona Pellucida. Fertil Steril. 93 (5): 1533-7.
  • KOHN MJ, et al. (2005) DKKL1 (Soggy), A Dickkopf Family Member, Localizes to the Acrosome During Mammalian Spermatogenesis. Mol Reprod Dev. 71 (4): 516-22.
  • Size / Price
    Catalog: HG10840-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions