Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MICB cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

MHC class I polypeptide-related sequence B, also known as MICB, is a heavily glycosylated protein serving as a ligand for the type I I receptor NKG2D. MICB shares 85% amino acid identity with MICA, a closely related protein, both of which contain three extracellular immunoglobulin-like domains, but without capacity to bind peptide or interact with beta-2-microglobulin. acting as a stress-induced self-antigen, binding of MICB to the NKG2D receptor activates the cytolytic response of natural killer (NK) cells, CD8+αβ T cells, and γδ T cells on which the receptor is expressed. MICA/B are minimally expressed on normal cells, but are frequently expressed on epithelial tumors and can be induced by bacterial and viral infections. MICA/B recognition thus is involved in tumor surveillance, viral infections, and autoimmune diseases.

  • Bauer, S. et al., 1999, Science. 285:727-729.
  • Braud, V.M. et al., 1999, Curr. Opin. Immunol. 11: 100-108.
  • Groh, V. et al., 2001, Nature Immunol. 2: 255-260.
  • Stephens, H., 2001, Trends Immunol. 22: 378-385.
  • Borrego, F. et al., 2002, Mol. Immunol. 38: 637–660.
  • Groh, V. et al., 2002, Nature. 419:734-738.
  • Images
      Recently Viewed Items