Quick Order

Text Size:AAA

Mouse PIGR Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PIGRcDNA Clone Product Information
Gene_bank_ref_id:NM_011082.2
cDNA Size:2316
cDNA Description:ORF Clone of Mus musculus polymeric immunoglobulin receptor DNA.
Gene Synonym:PIGR
Species:Mouse
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Polymeric immunoglobulin receptor, also known as PIGR, is a member of the immunoglobulin superfamily and a Fc receptor. The ectodomain of this receptor consists of five units with homology to the variable units of immunoglobulins and a transmembrane region, which also has some homology to certain immunoglobulin variable regions. PIGR is expressed on several glandular epithelia including those of liver and breast. The deduced amino-acid sequence has a length of 764 residues and shows an overall similarity of 56% and 64% with the rabbit and rat counterpart. PIGR mediates transcellular transport of polymeric immunoglobulin molecules, and thus facilitates the secretion of IgA and IgM. During this process, a cleavage occurs that separates the extracellular (known as the secretory component) from the transmembrane segment of PIGR.

References
  • Coyne, R. S. et al., 1995, J. Biol. Chem. 269 (50) :31620-31625. 
  • Kaetzel,C.S., 2001,  Curr Biol. 11(1): R35-38.
  • Size / Price
    Catalog:MG50119-CH
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"