Quick Order

Human PDK4 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PDK4cDNA Clone Product Information
Gene_bank_ref_id:NM_002612.3
cDNA Size:1236
cDNA Description:ORF Clone of Homo sapiens pyruvate dehydrogenase kinase, isozyme 4 DNA.
Gene Synonym:FLJ40832, PDK4
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 1A/T resulting in the amino acid 1Met substitution by Leu.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human PDK4 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged on other vectors
Human PDK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10743-ACG$325
Human PDK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10743-ACR$325
Human PDK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10743-ANG$325
Human PDK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10743-ANR$325
Human PDK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10743-CF$295
Human PDK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10743-CH$295
Human PDK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10743-CM$295
Human PDK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10743-CY$295
Human PDK4 Gene cDNA Clone (full-length ORF Clone)HG10743-M$95
Human PDK4 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10743-M-F$295
Human PDK4 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10743-M-N$295
Human PDK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10743-NF$295
Human PDK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10743-NH$295
Human PDK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10743-NM$295
Human PDK4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10743-NY$295
Human PDK4 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10743-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"