After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse CREG1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CREG1 cDNA Clone Product Information
Gene_bank_ref_id:NM_011804.2
RefSeq ORF Size:663bp
cDNA Description:Full length Clone DNA of Mus musculus cellular repressor of E1A-stimulated genes 1 with N terminal Myc tag.
Gene Synonym:Creg, AA755314, Creg1
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CREG1 belongs to the CREG family. It is a adenovirus E1A protein which both activates and represses gene expression to promote cellular proliferation and inhibit differentiation. Thus it may contribute to the transcriptional control of cell growth and differentiation. The transcriptional control activity of cell growth requires interaction with IGF2R. CREG1 also antagonizes transcriptional activation and cellular transformation by E1A. It shares limited sequence similarity with E1A and binds both the general transcription factor TBP and the tumor suppressor pRb in vitro. CREG1 gene may contribute to the transcriptional control of cell growth and differentiation.

References
  • Veal E, et al. (2000) The secreted glycoprotein CREG enhances differentiation of NTERA-2 human embryonal carcinoma cells. Oncogene. 19(17):2120-8.
  • Wen SJ, et al. (2003) Screening the proteins that interact with calpain in a human heart cDNA library using a yeast two-hybrid system. Hypertens Res. 25(4):647-52.
  • Grouse LH, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Size / Price
    Catalog: MG51049-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"