Quick Order

Human CSK Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CSKcDNA Clone Product Information
Gene_bank_ref_id:NM_001127190.1
cDNA Size:1353
cDNA Description:ORF Clone of Homo sapiens c-src tyrosine kinase DNA.
Gene Synonym:MGC117393, CSK
Species:Human
Vector:pCMV/hygro
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human CSK Gene cDNA Clone (full-length ORF Clone) expression ready, untagged on other vectors
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10740-ACG$325
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10740-ACR$325
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10740-ANG$325
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10740-ANR$325
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10740-CF$295
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10740-CH$295
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10740-CM$295
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10740-CY$295
Human CSK Gene cDNA Clone (full-length ORF Clone)HG10740-M$195
Human CSK Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10740-M-F$395
Human CSK Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10740-M-N$395
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10740-NF$295
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10740-NH$295
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10740-NM$295
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10740-NY$295
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10740-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

The tyrosine kinase c-Src has been implicated as a modulator of cell proliferation, spreading, and migration. These functions are also regulated by Met. The structure of a large fragment of the c-Src kinase comprises the regulatory and kinase domains and the carboxy-terminal tall. c-Src kinase interactions among domains and is stabilized by binding of the phosphorylated tail to the SH2 domain. This molecule is locked in a conformation that simultaneously disrupts the kinase active site and sequesters the binding surfaces of the SH2 and SH3 domains. The structure shows how appropriate cellular signals, or transforming mutations in v-Src, could break these interactions to produce an open, active kinase. The protein-tyrosine kinase activity of c-Src kinase is inhibited by phosphorylation of tyr527, within the c-Src c-terminal tail. Genetic and biochemical data have suggested that this negative regulation requires an intact Src homology 2 (SH2) domain. Since SH2 domains recognize phosphotyrosine, it is possible that these two non-catalytic domains associate, and thereby repress c-Src kinase activity. Experiments have suggested that c-Src kinase plays a role in the biological behaviour of colonic carcinoma cells induced by migratory factors such as EGF, perhaps acting in conjunction with FAK to regulate focal adhesion turnover and tumour cell motility. Furthermore, although c-Src kinase has been implicated in colonic tumour progression, in the adenoma to carcinoma in vitro model c-Src is not the driving force for this progression but co-operates with other molecules in carcinoma development.

References

References
  • Brauninger A. et al.,1992, Gene. 110: 205-11.
  • Sondhi D. et al., 1999, Biochemistry. 38 (34): 11147-55.
  • Ogawa A. et al., 2002, J Biol Chem. 277 (17): 14351-4.
  • Cole PA. et al., 2003, Curr Opin Chem Biol. 7 (5): 580-5.
  • Baumeister U. et al., 2005,EMBO J. 24 (9): 1686-95.
  • Size / Price
    Catalog:HG10740-M-N
    List Price: $395.00  (Save $100.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"