Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IRAK4 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Interleukin-1 receptor-associated kinase 4, also known as Renal carcinoma antigen NY-REN-64, IRAK-4 and IRAK4, is a member of the protein kinase superfamily, TKL Ser/Thr protein kinase family and Pelle subfamily. IRAK4 contains one death domain and one protein kinase domain. IRAK4 is required for the efficient recruitment of IRAK1 to the IL-1 receptor complex following IL-1 engagement, triggering intracellular signaling cascades leading to transcriptional up-regulation and mRNA stabilization. It also phosphorylates IRAK1. A member of the IL-1 receptor (IL-1R)-associated kinase (IRAK) family, IRAK4, has been shown to play an essential role in Toll-like receptor (TLR)-mediated signaling. IL-1-mediated IRAK4 kinase activity in T cells is essential for induction of IL-23R expression, Th17 differentiation, and autoimmune disease. Pharmacological blocking of IRAK4 kinase activity will retain some levels of host defence, while reducing the levels and duration of inflammatory responses, which should provide beneficial therapies for sepsis and chronic inflammatory diseases. Defects in IRAK4 are the cause of recurrent isolated invasive pneumococcal disease type 1 (IPD1) which is defined as two episodes of IPD occurring at least 1 month apart, whether caused by the same or different serotypes or strains. Recurrent IPD occurs in at least 2% of patients in most series, making IPD the most important known risk factor for subsequent IPD. Defects in IRAK4 are also the cause of IRAK4 deficiency which causes extracellular pyogenic bacterial and fungal infections in otherwise healthy children.

References
  • Strelow,A. et al., 2003, FEBS Lett. 547 (1-3):157-61.
  • Kim,T.W. et al., 2007, J Exp Med. 204 (5):1025-36.
  • Trumstedt,C. et al., 2007, J Leukoc Biol. 81 (6):1591-8.
  • Li,X. et al., 2008, Eur J Immunol. 38 (3):614-8.
  • Staschke,K.A. et al., 2009, J Immunol. 183 (1): 568-77. 
  • Images
      Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"