Quick Order

Text Size:AAA

Human LRAP / ERAP2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ERAP2 cDNA Clone Product Information
RefSeq ORF Size:2883bp
cDNA Description:Full length Clone DNA of Homo sapiens endoplasmic reticulum aminopeptidase 2.
Gene Synonym:LRAP, L-RAP, FLJ23633, FLJ23701, FLJ23807, ERAP2
Restriction Site:HindIII + XhoI (5.5kb + 2.88kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations 1305 T/A, 1689 G/A, 2229 C/T, 2325 C/T and 2611 C/T not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Leukocyte-derived arginine aminopeptidase (LRAP), also known as endoplasmic reticulum-aminopeptidase 2 (ERAP2), is the second identified aminopeptidase localized in the in the lumenal side of endoplasmic reticulum (ER) processing antigenic peptides presented to major histocompatibility complex (MHC) class I molecules. It is a 960-amino acid protein with significant homology to placental leucine aminopeptidase and adipocyte-derived leucine aminopeptidase. LRAP preferentially hydrolyzes the basic residues Arg and Lys, and contains the HEXXH(X)18E zinc-binding motif, which is the characteristic of the M1 family of zinc metallopeptidases which also includes PILS/ARTS1/ERAP1 and LNPEP/PLAP. Induced by interferon-gamma, LRAP is able to trim various MHC class I antigenic peptide precursors.

Size / Price
Catalog: HG10734-M-N
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions