Quick Order

Text Size:AAA

Mouse CCL24 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CCL24 cDNA Clone Product Information
Gene_bank_ref_id:NM_019577.4
RefSeq ORF Size:360bp
cDNA Description:Full length Clone DNA of Mus musculus chemokine (C-C motif) ligand 24 with C terminal His tag.
Gene Synonym:CKb-6, MPIF-2, Scya24, Ccl24
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Background

CCL24, also known as Eotaxin-2 and MPIF-2, belongs to the intercrine beta (chemokine CC) family. CCL24 gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. CCL24 displays chemotactic activity on resting T lymphocytes, a minimal activity on neutrophils, and is negative on monocytes and activated T lymphocytes. CCL24 is also a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. CCL24 is chemotactic for resting T-lymphocytes, and eosinophils. It has lower chemotactic activity for neutrophils but none for monocytes and activated lymphocytes. It is a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. Eotaxin-2 interacts with chemokine receptor CCR3 to induce chemotaxis in eosinophils. Elevated level of Eotaxin-2 has been seen in patients with aspirin-exacerbated respiratory disease.

References
  • Manousou P, et al. (2010) Increased expression of chemokine receptor CCR3 and its ligands in ulcerative colitis: the role of colonic epithelial cells in in vitro studies. Clin Exp Immunol. 162 (2): 337-47.
  • Owczarek W, et al. (2010) Analysis of eotaxin 1/CCL11, eotaxin 2/CCL24 and eotaxin 3/CCL26 expression in lesional and non-lesional skin of patients with atopic dermatitis. Cytokine. 50 (2): 181-5.
  • Luesink M, et al. (2009) Chemokine induction by all-trans retinoic acid and arsenic trioxide in acute promyelocytic leukemia: triggering the differentiation syndrome. Blood. 114 (27): 5512-21.
  • Size / Price
    Catalog: MG50104-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"