After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TRIB3 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TRIB3cDNA Clone Product Information
cDNA Size:1077
cDNA Description:ORF Clone of Homo sapiens tribbles homolog 3 (Drosophila) DNA.
Gene Synonym:NIPK, SINK, TRB3, SKIP3, C20orf97, TRIB3
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 333T/C not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human TRIB3 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged on other vectors
Human TRIB3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10731-ACG$325
Human TRIB3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10731-ACR$325
Human TRIB3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10731-ANG$325
Human TRIB3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10731-ANR$325
Human TRIB3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10731-CF$295
Human TRIB3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10731-CH$295
Human TRIB3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10731-CM$295
Human TRIB3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10731-CY$295
Human TRIB3 Gene cDNA Clone (full-length ORF Clone)HG10731-M$95
Human TRIB3 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10731-M-F$295
Human TRIB3 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10731-M-N$295
Human TRIB3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10731-NF$295
Human TRIB3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10731-NH$295
Human TRIB3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10731-NM$295
Human TRIB3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10731-NY$295
Human TRIB3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10731-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Tribbles homolog 3, also known as Neuronal cell death-inducible putative kinase, p65-interacting inhibitor of NF-kappa-B, SINK and TRIB3, is a Nucleus protein which belongs to the protein kinase superfamily and CAMK Ser/Thr protein kinase family and Tribbles subfamily. Highest expression Of TRIB3 is in liver, pancreas, peripheral blood leukocytes and bone marrow. It is also highly expressed in a number of primary lung, colon and breast tumors. TRIB3 is expressed in spleen, thymus, and prostate and is undetectable in other examined tissues, including testis, ovary, small intestine, colon, leukocyte, heart, brain, placenta, lung, skeletal muscle, and kidney. TRIB3 disrupts insulin signaling by binding directly to Akt kinases and blocking their activation. TRIB3 may bind directly to and mask the 'Thr-308' phosphorylation site in AKT1. It binds to ATF4 and inhibits its transcriptional activation activity. TRIB3 interacts with the NF-kappa-B transactivator p65 RELA and inhibits its phosphorylation and thus its transcriptional activation activity. It interacts with MAPK kinases and regulates activation of MAP kinases. It may play a role in programmed neuronal cell death but does not appear to affect non-neuronal cells. TRIB3 does not display kinase activity.

  • Wu M. et al., 2003, J. Biol. Chem. 278: 27072-9.
  • Kiss-Toth E. et al., 2004, J. Biol. Chem. 279: 42703-8.
  • Ord D., et al.,2005, Biochem. Biophys. Res. Commun. 330: 210-8.
  • Schwarzer R. et al., 2006, Cell. Signal. 18:899-909.
  • Greenman C. et al., 2007, Nature. 446:153-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
      Recently Viewed Items