Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TRIB2 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Tribbles homolog 2, also known as TRB-2, and Trib2, is a member of the protein kinase superfamily and Tribbles subfamily (Trib1, Trib2, Trib3). The identification of tribbles as regulators of signal processing systems and physiological processes, including development, together with their potential involvement in diabetes and cancer, has generated considerable interest in these proteins. Tribbles have been reported to regulate activation of a number of intracellular signalling pathways with roles extending from mitosis and cell activation to apoptosis and modulation of gene expression. Tribbles controls the timing of mitosis in the prospective mesoderm, allowing cell-shape changes to be completed. This mechanism for coordinating cell division and cell-shape changes may have helped Drosophila to evolve its mode of rapid early development. Trib2 was identified as a downregulated transcript in leukemic cells undergoing growth arrest. Trib2-transduced bone marrow cells exhibited a growth advantage and readily established factor-dependent cell lines. Trib2-reconstituted mice uniformly developed fatal transplantable acute myelogenous leukemia (AML).

References
  • Seher, TC. et al., 2000, Curr Biol. 10 (11): 623-9.
  • Keeshan, K. et al., 2006, Cancer Cell. 10 (5): 401-11.
  • Hegedus, Z. et al., 2007, Cell Signal. 19 (2):238-50.
  • Keeshan, K. et al., 2008, Blood Cells Mol Dis. 40 (1): 119-21.
  • Cvetkovic, LV. et al., 2010, J Clin Invest. 120 (3): 713-9.
  • Images
      Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"