Quick Order

Text Size:AAA

Human COL5A2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human COL5A2 cDNA Clone Product Information
Gene_bank_ref_id:NM_000393.3
RefSeq ORF Size:4500bp
cDNA Description:Full length Clone DNA of Homo sapiens collagen, type V, alpha 2 with N terminal HA tag.
Gene Synonym:COL5A2
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

COL5A2 is a component of type V collagen. It is known as the pro-alpha2(V) chain. COL5A2, together with two pro-alpha1(V) chains can form type V procollagen. These triple-stranded, rope-like procollagen molecules arrange themselves into long, thin fibrils that cross-link to one another in the spaces around cells. The cross-links result in the formation of very strong, mature type V collagen fibers. Type V collagen can be detected in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen.

References
  • Greenspan DS. et al., 1992, Genomics. 12 (4): 836-7.
  • Mann K. 1992, Biol Chem Hoppe-Seyler. 373 (2): 69-75.
  • Greenspan DS. et al., 1992, Gene Expr. 1 (1): 29-39.
  • Size / Price
    Catalog: HG13685-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"