After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SHPK ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SHPK cDNA Clone Product Information
Gene_bank_ref_id:BC020543
RefSeq ORF Size:1437bp
cDNA Description:Full length Clone DNA of Homo sapiens sedoheptulokinase with C terminal HA tag.
Gene Synonym:SHK, CARKL
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CARKL, also known as SHPK, is a nonprotein kinase of glucose metabolism. CARKL has weak homology to several carbohydrate kinases, a class of proteins involved in the phosphorylation of sugars as they enter a cell, inhibiting return across the cell membrane. CARKL catalyzes an orphan reaction in the pentose phosphate pathway, refocusing cellular metabolism to a high-redox state upon physiological or artificial downregulation. CARKL-dependent metabolic reprogramming is required for proper M1- and M2-like macrophage polarization and uncover a rate-limiting requirement for appropriate glucose flux in macrophage polarization.

References
  • Haschemi A. et al., 2012, Cell Metab. 15 (6): 813-26.
  • Udeshi ND. et al., 2012, Mol Cell Proteomics. 11 (5): 148-59.
  • Wamelink MM. et al., 2008, Hum Mutat. 29 (4): 532-6.
  • Size / Price
    Catalog: HG14833-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"