After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse BACE2 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse BACE2 cDNA Clone Product Information
Gene_bank_ref_id:NM_019517.4
RefSeq ORF Size:1545bp
cDNA Description:Full length Clone DNA of Mus musculus beta-site APP-cleaving enzyme 2 with N terminal Myc tag.
Gene Synonym:ARP1, BAE2, DRAP, AEPLC, ALP56, ASP21, CDA13, CEAP1, AI850424, 1110059C24Rik, Bace2
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

BACE2, also known as beta secretase 2, belongs to the peptidase A1 family. It is a protease known to be an important enzyme involved in the cellular pathways. BACE2 has been shown to interact with GGA1 and GGA2. It is the major β-secretase in vivo. BACE2 is located on chromosome 21 and may play a role in alzheimer's disease pathogenesis in down syndrome(DS). Overexpression of BACE2 by lentivirus markedly reduced amyloid β protein production in primary neurons. Despite an extra copy of the BACE2 gene in DS and the increase of its transcription, BACE2 protein levels are unchanged.

References
  • Hussain I, et al. (2001) Prodomain processing of Asp1 (BACE2) is autocatalytic. J Biol Chem. 276(26):23322-8.
  • Solans A, et al. (2000) A new aspartyl protease on 21q22.3, BACE2, is highly similar to Alzheimer's amyloid precursor protein beta-secretase. Cytogenet Cell Genet. 89(3-4): 177-84.
  • Hussain I, et al. (2001) ASP1 (BACE2) cleaves the amyloid precursor protein at the beta-secretase site. Mol Cell Neurosci. 16(5):609-19.
  • Size / Price
    Catalog: MG51031-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"