After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CSNK1G3cDNA Clone Product Information
Gene_bank_ref_id:NM_001044722.1
cDNA Size:1248
cDNA Description:ORF Clone of Homo sapiens casein kinase 1, gamma 3, transcript variant 3 DNA.
Gene Synonym:CSNK1G3
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged on other vectors
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10719-ACG$325
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10719-ACR$325
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10719-ANG$325
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10719-ANR$325
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10719-CF$295
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10719-CH$295
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10719-CM$295
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10719-CY$295
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone)HG10719-M$95
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10719-M-F$295
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10719-M-N$295
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10719-NF$295
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10719-NH$295
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10719-NM$295
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10719-NY$295
Human CSNK1G3 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10719-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"