Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CLK3 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Dual specificity protein kinase CLK3, also known as CDC-like kinase 3, and CLK3, is a member of CMGC Ser/Thr protein kinase family and Lammer subfamily. Mammalian CLK is the prototype for a family of dual specificity kinases (termed Lammer kinases) that have been conserved in evolution. CLK family members have shown to interact with, and phosphorylate, serine- and arginine-rich (SR) proteins of the spliceosomal complex, which is a part of the regulatory mechanism that enables the SR proteins to control RNA splicing. The three members of the CLK family of kinases (CLK1, CLK2, and CLK3) have been shown to undergo conserved alternative splicing to generate catalytically active and inactive isoforms. The human CLK2 and CLK3 are found within the nucleus and display dual-specificity kinase activity. The truncated isoforms, hCLK2(T) and hCLK3(T), colocalize with SR proteins in nuclear speckles. CLK3 may play a role in the development and progression of azoospermia.

  • Duncan, PI. et al., 1998, Exp. Cell Res. 241: 300 - 8.
  • Menegay, H. et al., 1999, Exp Cell Res. 253 (2): 463-73.
  • García-Sacristán, A. et al., 2005, Cell Res. 15 (7): 495-503.
  • Bullock, AN. et al., 2009, Structure  17 (3): 352-62.
  • Images
      Recently Viewed Items