After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human MAP3K2 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MAP3K2cDNA Clone Product Information
Gene_bank_ref_id:NM_006609.3
cDNA Size:1860
cDNA Description:ORF Clone of Homo sapiens mitogen-activated protein kinase kinase kinase 2 DNA.
Gene Synonym:MEKK2, MEKK2B, MAP3K2
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 861T/C not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human MAP3K2 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged on other vectors
Human MAP3K2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10712-ACG$345
Human MAP3K2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10712-ACR$345
Human MAP3K2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10712-ANG$345
Human MAP3K2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10712-ANR$345
Human MAP3K2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10712-CF$315
Human MAP3K2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10712-CH$315
Human MAP3K2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10712-CM$315
Human MAP3K2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10712-CY$315
Human MAP3K2 Gene cDNA Clone (full-length ORF Clone)HG10712-M$195
Human MAP3K2 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10712-M-F$395
Human MAP3K2 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10712-M-N$395
Human MAP3K2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10712-NF$315
Human MAP3K2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10712-NH$315
Human MAP3K2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10712-NM$315
Human MAP3K2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10712-NY$315
Human MAP3K2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10712-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:HG10712-M-N
List Price: $395.00  (Save $80.00)
Price:$315.00      [How to order]
Availability5 business days
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"