Quick Order

DatasheetReviewsRelated ProductsProtocols
Human PTK6 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Tyrosine kinase (PTKs) is a protein that carry out tyrosine phosphorylation, which play a fundamental role in cell proliferation, survival, adhesion, and motility and have also been demenstrated to mediate malignant cell transformation. Overexpression of this protein in mammary epithelial cells leads to sensitization of the cells to epidermal growth factor and results in a partially transformed phenotype. Two classes of PTKs are present in cells: the transmembrane receptor PTKs and the non-receptor PTKs. Tyrosine kinase(PTKs)-6/ BRK is a cytoplasmic non-receptor protein kinase which may function as an intracellular signal transducer in epithelial tissues. Tyrosine kinase(PTKs)-6/ BRK has been shown to undergo autophosphorylation. It has been found that the constitutive expression of the tyrosine kinase(PTKs)-6/ BRK is in a large proportion of cutaneous T-cell lymphomas and other transformed T- and B-cell populations. State BRK expression was also induced in normal T-cells. In clinical, the cytoplasmic tyrosine kinase PTK6 (BRK) shows elevated expression in approximately two-thirds of primary breast tumours, and is implicated in EGF receptor-dependent signalling and epithelial tumorigenesis.

  • Aubele M, et al. (2008) Prognostic value of protein tyrosine kinase 6 (PTK6) for long-term survival of breast cancer patients.British Journal of Cancer. 99: 1089-95.
  • Kasprzycka M, et al. (2006) Expression and oncogenic role of Brk (PTK6/sik) protein tyrosine kinase in lymphocytes. American Journal of Pathology. 168: 1631-41.
  • Hubbard SR, et al. (2000) Protein tyrosine kinase structure and function. Annual review of biochemistry. 69: 373-98.
  • Images
        Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.