Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ULBP1 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

UL16-binding proteins (ULBP) or retinoic acid early transcripts-1 (RAET1) are ligands to the activating receptor, NKG2D. Ten members of the human ULBP/RAET1 gene family have been identified to encode for potentially functional proteins, and have tissue-specific expressions. ULBP1, also known as RAET1I and NKG2DL1, together with at least ULBP 2 and 3, are well-known ligands for NKG2D, and activate multiple signaling pathways in primary NK cells, resulting in the production of cytokines and chemokines. ULBP1 is expressed in T-cells, B-cells, erythroleukemia cell lines and in a wide range of tissues including heart, brain, lung, liver and bone marrow, as well as some tumor cells. As an unconventional member of the MHC class I family, ULBP1 function in immune responses, especially in cancer and infectious diseases. Unlike other ULBP members, ULBP1 is able to interact with soluble CMV glycoprotein UL16 in CMV infected cells. The interaction with UL16 blocked the interaction with the NKG2D receptor, and thus might escape the immune surveillance. Furthermore, UL16 also causes ULBP1 to be retained in the ER and cis-Golgi apparatus so that it does not reach the cell surface. The ULBP1 regulation may have implications for development of new therapeutic strategies against cancer cells.

References

1.  Rölle, A. et al., 2003, J Immunol. 171(2): 902-908.  

2.  López-Soto, A. et al., 2006, J Biol Chem. 281(41): 30419-30430.      

3.  Song, H. et al., 2006, Cell Immunol. 239(1): 22-30.  

4.  Eisele, G. et al., 2006, Brain. 129 (9): 2416-2425.   

5.  Romphruk, AV. et al., 2009, Immunogenetics. 61(9): 611-617. 

6.  Sutherland, C.L. et. al., 2002, J. Immunol. 168: 671-679.

Images
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"