After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse ACPP Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACPPcDNA Clone Product Information
cDNA Size:1254
cDNA Description:ORF Clone of Mus musculus acid phosphatase, prostate DNA.
Gene Synonym:Lap, PAP, Ppal, AI324033, A030005E02Rik, Acpp
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Prostatic acid phosphatase (PAP, or ACPP), also known as prostatic specific acid phosphatase (PSAP), is an enzyme produced by the prostate. As a non-specific phosphomonoesterase, Prostatic acid phosphatase synthetized and secreted into seminal plasma under androgenic control. The enzyme is a dimer of molecular weight around 100 kDa. Prostatic acid phosphatase is a clinically important protein for its relevance as a biomarker of prostate carcinoma. Furthermore, it has a potential role in fertilization. The major action of PAP is to dephosphorylate macromolecules with the help of catalytic residues (His(12) and Asp(258)) that are located in the cleft between two domains. Cellular prostatic acid phosphatase (cPAcP), an authentic tyrosine phosphatase, is proposed to function as a negative growth regulator of prostate cancer (PCa) cells in part through its dephosphorylation of ErbB-2. cPAcP functions as a neutral protein tyrosine phosphatase (PTP) in prostate cancer cells and dephosphorylates HER-2/ErbB-2/Neu (HER-2: human epidermal growth factor receptor-2) at the phosphotyrosine (p-Tyr) residues. Injection of the secretory isoform of PAP has potent antinociceptive effects in mouse models of chronic pain. This enzyme exhibits ecto-5'-nucleotidase activity, is widely distributed, and implicated in the formation of chronic pain. Additionally, PAP could be a target molecule in specific immunotherapy for patients with nonprostate adenocarcinomas including colon and gastric cancers.

  • Hassan MI, et al. (2010) Structural and functional analysis of human prostatic acid phosphatase. Expert Rev Anticancer Ther. 10(7): 1055-68.
  • Chuang TD, et al. (2010) Human prostatic acid phosphatase, an authentic tyrosine phosphatase, dephosphorylates ErbB-2 and regulates prostate cancer cell growth. J Biol Chem. 285(31): 23598-606.
  • Larsen RS, et al. (2009) A high throughput assay to identify small molecule modulators of prostatic acid phosphatase. Curr Chem Genomics. 3: 42-9.
  • Zimmermann H. (2009) Prostatic acid phosphatase, a neglected ectonucleotidase. Purinergic Signal. 5(3): 273-5.
  • Wang Y, et al. (2005) Prostatic acid phosphatase as a target molecule in specific immunotherapy for patients with nonprostate adenocarcinoma. J Immunother. 28(6): 535-41.
  • Veeramani S, et al. (2005) Cellular prostatic acid phosphatase: a protein tyrosine phosphatase involved in androgen-independent proliferation of prostate cancer. Endocr Relat Cancer. 12(4): 805-22.
  • Ostrowski WS, et al. (1994) Human prostatic acid phosphatase: selected properties and practical applications. Clin Chim Acta. 226(2): 121-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items