Quick Order

Text Size:AAA

Human PPP3CA transcript variant 2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PPP3CA cDNA Clone Product Information
Gene_bank_ref_id:NM_001130691.1
RefSeq ORF Size:1536bp
cDNA Description:Full length Clone DNA of Homo sapiens protein phosphatase 3, catalytic subunit, alpha isozyme, transcript variant 2 with N terminal HA tag.
Gene Synonym:CALN, CCN1, CNA1, CALNA, PPP2B, CALNA1, PPP3CA
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

PPP3CA, also known as protein phosphatase 2B, is a member of the PPP phosphatase family, PP-2B subfamily. It is the alpha catalytic subunit of protein phosphatase 2B (PP2B). PP2B is a holoenzyme that is comprised of a catalytic subunit associated with regulatory subunits. It is a calcium regulated enzyme that is activated by calmodulin and participates in the signaling cascades involved in development of the nervous, cardiovascular, and musculoskeletal systems. PPP3CA activates the T cells of the immune system and can be blocked by drugs. It also activates NFATc (a transcription factor) by dephosphorylating it. The activated NFATc is subsequently translocated into the nucleus, where it upregulates the expression of interleukin 2. PPP3CA interacts with CRTC2, MYOZ1, MYOZ2 and MYOZ3. It also interacts with DNM1L. The interaction dephosphorylates DNM1L and regulates its translocation to mitochondria.

References
  • Frey N, et al. (2002) Calsarcin-3, a Novel Skeletal Muscle-specific Member of the Calsarcin Family, Interacts with Multiple Z-disc Proteins. Journal of Biological Chemistry. 277(16): 13998-4004.
  • Frey N, et al. (2000) Calsarcins, a novel family of sarcomeric calcineurin-binding proteins. Proceedings of the National Academy of Sciences. 97(26):14632-7.
  • Crabtree G R, et al. (1999) Generic signals and specific outcomes: Signaling through Ca2+, calcineurin, and NF-AT. Cell. 96(5):611-4.
  • Size / Price
    Catalog: HG13669-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"