After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CD200 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD200cDNA Clone Product Information
cDNA Size:837
cDNA Description:ORF Clone of Mus musculus CD200 antigen DNA.
Gene Synonym:OX2, Mox2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

CD200 (OX-2) is a cell surface glycoprotein that imparts immune privileges by suppressing alloimmune and autoimmune responses through its receptor, CD200R, expressed primarily on myeloid cells. Signals delivered through the CD200:CD200R axis have been shown to play an important role in the regulation of anti-tumor immunity, and overexpression of CD200 has been reported in a number of malignancies, including CLL, as well as on cancer stem cells. The role of CD200-CD200R signaling in immune regulation of the central nervous system has become a popular field of research in recent years. Many studies have shown that there is a close correlation between CD200-CD200R, microglia activation, and Parkinson's disease (PD). The ability of CD200 to suppress myeloid cell activation is critical for maintaining normal tissue homeostasis but may also enhance the survival of migratory neoplastic cells. CD200 and CD200R associate via their respective N-terminal Ig-like domains. CD200 has been characterized as an important immunoregulatory molecule, increased expression of which can lead to decreased transplant rejection, autoimmunity, and allergic disease. Elevated CD200 expression has been reported to be associated with poor prognosis in a number of human malignancies. In addition, CD200 also plays an important role in prevention of graft rejection, autoimmune diseases and spontaneous abortion.

  • Minas K, et al. (2006) Is the CD200/CD200 receptor interaction more than just a myeloid cell inhibitory signal? Crit Rev Immunol. 26(3): 213-30.
  • Wang XJ, et al. (2007) CD200-CD200R regulation of microglia activation in the pathogenesis of Parkinson's disease. J Neuroimmune Pharmacol. 2(3): 259-64.
  • Wong KK, et al. (2010) The role of CD200 in immunity to B cell lymphoma. J Leukoc Biol. 88(2): 361-72.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items