Quick Order

Human BBS7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BBS7cDNA Clone Product Information
cDNA Size:2148
cDNA Description:ORF Clone of Homo sapiens Bardet-Biedl syndrome 7, transcript variant 1 DNA.
Gene Synonym:BBS2L1, FLJ10715
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human BBS7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, untagged on other vectors
Human BBS7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10627-ACG$345
Human BBS7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10627-ACR$345
Human BBS7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10627-ANG$345
Human BBS7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10627-ANR$345
Human BBS7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10627-CF$315
Human BBS7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10627-CH$315
Human BBS7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10627-CM$315
Human BBS7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10627-CY$315
Human BBS7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10627-M$195
Human BBS7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10627-M-F$445
Human BBS7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10627-M-N$445
Human BBS7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10627-NF$315
Human BBS7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10627-NH$315
Human BBS7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10627-NM$315
Human BBS7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10627-NY$315
Human BBS7 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10627-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $445.00  (Save $130.00)
Price:$315.00      [How to order]
Availability5 business days
    Recently Viewed Items