Quick Order

Mouse CXCL2 / MIP-2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CXCL2cDNA Clone Product Information
cDNA Size:303
cDNA Description:ORF Clone of Mus musculus chemokine (C-X-C motif) ligand 2 DNA.
Gene Synonym:GROb, Gro2, Mip2, Scyb, MIP-2, Scyb2, MIP-2a, Mgsa-b, CINC-2a, Cxcl2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Chemokine & Receptor Related Products
Product nameProduct name

Chemokine (C-X-C motif) ligand 2 (CXCL2), also called macrophage inflammatory protein 2 (MIP-2), Growth-regulated protein beta (Gro-beta) and Gro oncogene-2 (Gro-2), is a small cytokine belonging to the CXC chemokine family. CXCL2/MIP-2 is selectively up-regulated in tolerance-conferring APCs and serves to recruit NKT cells to the splenic marginal zone, where they form clusters with APCs and T cells. In the absence of the high-affinity receptor for CXCL2/MIP-2 or in the presence of a blocking Ab to CXCL2/MIP-2, peripheral tolerance is prevented, and Ag-specific T regulatory cells are not generated. CXCL2/MIP-2 is selectively up-regulated in tolerance-conferring APCs and serves to recruit NKT cells to the splenic marginal zone, where they form clusters with APCs and T cells. In the absence of the high-affinity receptor for MIP-2 (as in CXCR2-deficient mice) or in the presence of a blocking Ab to MIP-2, peripheral tolerance is prevented, and Ag-specific T regulatory cells are not generated. Understanding the regulation of lymphocyte traffic during tolerance induction may lead to novel therapies for autoimmunity, graft acceptance, and tumor rejection. Several studies have implicated the CXCL2 chemokine as a mediator in the development of sepsis. CXCL2/MIP-2 also plays a major role in mediating the neutrophilic inflammatory response of the rodent lung to particles such as quartz, crocidolite asbestos, as well as high doses of other relative innocuous dusts such as titanium dioxide.

  • Driscoll KE. (2000) TNFalpha and MIP-2: role in particle-induced inflammation and regulation by oxidative stress. Toxicol Lett. 112-113: 177-83.
  • Walpen S, et al. (2001) Nitric oxide induces MIP-2 transcription in rat renal mesangial cells and in a rat model of glomerulonephritis. FASEB J. 15(3): 571-3.
  • Fahey TJ, et al. (1990) Cytokine production in a model of wound healing: the appearance of MIP-1, MIP-2, cachectin/TNF and IL-1. Cytokine. 2(2): 92-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks