CDK4 cDNA ORF Clone, Mouse, N-OFPSpark® tag

Price:
Size:
Number:

CDK4 cDNA ORF Clone, Mouse, N-OFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
912 bp
Description
Full length Clone DNA of Mouse cyclin-dependent kinase 4 with N terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CDK4 cDNA ORF Clone, Mouse, N-OFPSpark® tag: Alternative Names

Crk3 cDNA ORF Clone, Mouse

CDK4 Background Information

CDK4 is a member of the Ser/Thr protein kinase family. It is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of CDK4 is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). CDK4 was shown to be responsible for the phosphorylation of retinoblastoma gene product. CDK4 is the ser/Thr-kinase component of cyclin D-CDK4 (DC) complexes that phosphorylate and inhibit members of the retinoblastoma (RB) protein family including RB1 and regulate the cell-cycle during G(1)/S transition. Phosphorylation of RB1 allows dissociation of the transcription factor E2F from the RB/E2F complexes and the subsequent transcription of E2F target genes which are responsible for the progression through the G(1) phase. Hypophosphorylates RB1 in early G(1) phase. Cyclin D-CDK4 complexes are major integrators of various mitogenenic and antimitogenic signals. CDK4 has been shown to be mutated in some types of cancer, whilst a chromosomal rearrangement can lead to Cdk6 overexpression in lymphoma, leukemia and melanoma.
Full Name
cyclin-dependent kinase 4
References
  • Stepanova L, et al. (1996) Mammalian p50Cdc37 is a protein kinase-targeting subunit of Hsp90 that binds and stabilizes Cdk4. Genes Dev. 10(12):1491-502.
  • Lamphere L, et al. (1997) Interaction between Cdc37 and Cdk4 in human cells. Oncogene. 14(16): 1999-2004.
  • Dai K, et al. (1996) Physical interaction of mammalian CDC37 with CDK4. J Biol Chem. 271(36): 22030-4.
  • Sugimoto M, et al. (1999) Regulation of CDK4 activity by a novel CDK4-binding protein, p34SEI-1. Genes Dev. 13(22):3027-33.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait