MERS-CoV (NCoV / Novel coronavirus) orf3 Gene ORF cDNA clone expression plasmid, N-Flag tag

Price:
Size:
Number:

MERS-CoV (NCoV / Novel coronavirus) orf3 Gene ORF cDNA clone expression plasmid, N-Flag tag: General Information

Gene
Species
MERS-CoV
NCBI Ref Seq
RefSeq ORF Size
312 bp
Sequence Description
Identical with the Gene Bank AFS88937 sequence.
Description
Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) orf3 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait