Survivin cDNA ORF Clone, Human, N-OFPSpark® tag

Price:
Size:
Number:

Survivin cDNA ORF Clone, Human, N-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
429 bp
Description
Full length Clone DNA of Human baculoviral IAP repeat-containing 5, transcript variant 1 with N terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Survivin cDNA ORF Clone, Human, N-OFPSpark® tag: Alternative Names

API4 cDNA ORF Clone, Human; BIRC5 cDNA ORF Clone, Human; EPR-1 cDNA ORF Clone, Human; IAP4 cDNA ORF Clone, Human

Survivin Background Information

BIRC5, also known as Survivin and EPR-1, is a member of theIAP family. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but BIRC5 has only a single BIR domain. It is expressed cell cycle-dependently and highly expressed at mitosis. As a multitasking protein, BIRC5 has dual roles in promoting cell proliferation and preventing apoptosis. Survivin is a component of a chromosome passage protein complex (CPC) which is essential for chromosome alignment and segregation during mitosis and cytokinesis. Survivin acts as an important regulator of the localization of this complex. It may counteract a default induction of apoptosis in G2/M phase.
Full Name
baculoviral IAP repeat containing 5
References
  • Altieri DC. 1994, J Biol Chem. 269 (5): 3139-42.
  • Bouchard BA. et al., 2002, Thromb Haemost. 86 (4): 1133-5.
  • Yao XQ. et al., 2004, World J Gastroenterol. 10 (9): 1262-7.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait