PMP2 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

Price:
Size:
Number:

PMP2 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
399 bp
Description
Full length Clone DNA of Human peripheral myelin protein 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

PMP2 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Alternative Names

FABP8 cDNA ORF Clone, Human; M-FABP cDNA ORF Clone, Human; MP2 cDNA ORF Clone, Human; P2 cDNA ORF Clone, Human

PMP2 Background Information

Myelin P2 protein, also known as PMP2, is a cytosolic protein found primarily in peripheral nerves. It Belongs to thecalycin superfamily.Fatty-acid binding protein (FABP) family. PMP2 is a small, basic, and cytoplasmic lipid binding protein of peripheral myelin. It is similar in amino acid sequence and tertiary structure to fatty acid binding proteins found in the liver, adipocytes, and intestine, its expression is limited to the nervous system. PMP2 is detected only in myelin-producing cells of the central and peripheral nervous systems, the oligodendrocytes and Schwann cells, respectively. PMP2 may play a role in lipid transport protein in Schwann cells. It forms a beta-barrel structure that accommodates hydrophobic ligands in its interior.
Full Name
peripheral myelin protein 2
References
  • Hayasaka, K. et al., 1993, Genomics. 18 (2): 244-8.
  • Polverini, E. et al., 2006, J Struct Biol. 153 (3): 253-63.
  • Gould,R.M. et al., 2008, Neuron Glia Biol. 4 (2):137-52.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait