PDK4 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

PDK4 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1236 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human pyruvate dehydrogenase kinase, isozyme 4 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XhoI (5.4kb + 1.29kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

PDK4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDK4 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Alternative Names

PDHK4 cDNA ORF Clone, Human

PDK4 Background Information

Pyruvate dehydrogenase kinase 4 (PDK4) is a mitochondrial protein that regulates the TCA cycle.PDK4, a vital mitochondrial protein, controls the switch between glycolysis and oxidative phosphorylation based upon nutrient availability.Pyruvate dehydrogenase kinase 4 (PDK4) mRNA has been reported as an up-regulated gene in the heart and skeletal muscle of carnitine-deficient juvenile visceral steatosis (JVS) mice under fed conditions. PDK4 plays an important role in the inhibition of glucose oxidation via the phosphorylation of pyruvate dehydrogenase complex (PDC).PDK4 gene expression is stimulated by thyroid hormone (T(3)), glucocorticoids, and long chain fatty acids.
Full Name
pyruvate dehydrogenase kinase 4
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait