ANGPTL1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

ANGPTL1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1476 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human angiopoietin-like 1 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
HindIII + XhoI (5.4kb + 1.53kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

ANGPTL1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ANGPTL1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Alternative Names

ANG3 cDNA ORF Clone, Human; ANGPT3 cDNA ORF Clone, Human; AngY cDNA ORF Clone, Human; ARP1 cDNA ORF Clone, Human; dJ595C2.2 cDNA ORF Clone, Human; UNQ162 cDNA ORF Clone, Human

ANGPTL1 Background Information

Angiopoietin-like protein 1 (ANGPTL1) has been reported to suppress migration and invasion in lung and breast cancer, acting as a novel tumor suppressor candidate. Downregulation of tumor suppressor signaling plays an important role in the pathogenesis of hepatocellular carcinoma (HCC).The downregulation of the angiopoietin-like protein ANGPTL1 is associated with vascular invasion, tumor thrombus, metastasis, and poor prognosis in HCC. Ectopic expression of ANGPTL1 in HCC cells effectively decreased their in vitro and in vivotumorigenicity, cell motility, and angiogenesis. shRNA-mediated depletion of ANGPTL1 exerted opposing effects. ANGPTL1 promoted apoptosis via inhibition of the STAT3/Bcl-2-mediated antiapoptotic pathway and decreased cell migration and invasion via downregulation of transcription factors SNAIL and SLUG. Furthermore, ANGPTL1 inhibited angiogenesis by attenuating ERK and AKT signaling and interacted with integrin α1β1 receptor to suppress the downstream FAK/Src-JAK-STAT3 signaling pathway. Taken together, these results suggest ANGPTL1 as a prognostic biomarker and novel therapeutic agent in HCC. ANGPTL1 expression was down-regulated in CRC tissues and inversely correlated with poor survival. ANGPTL1 repressed migration and invasion of CRC cells, and microRNA-138 was involved in this process. Angiopoietin-like protein 1 (ANGPTL1) has been shown to act as a tumor suppressor by inhibiting angiogenesis, cancer invasion, and metastasis.
Full Name
angiopoietin-like 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait