Sino Biological - Official Website

CD98 cDNA ORF Clone, Cynomolgus, C-His tag

Price:
Size:
Number:

CD98 cDNA ORF Clone, Cynomolgus, C-His tag: General Information

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1590 bp
Description
Full length Clone DNA of Cynomolgus uncharacterized LOC101866986 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD98 Background Information

4F2 cell-surface antigen heavy chain, also known as 4F2 heavy chain antigen, Lymphocyte activation antigen 4F2 large subunit, CD98, SLC3A2 and MDU1, is a single-pass type I I membrane protein which belongs to the SLC3A transporter family. SLC3A2 / MDU1 is expressed ubiquitously in all tissues tested with highest levels detected in kidney, placenta and testis and weakest level in thymus. During gestation, expression in the placenta is significantly stronger at full-term than at the mid-trimester stage. SLC3A2 / MDU1 is expressed in HUVECS and at low levels in resting peripheral blood T-lymphocytes and quiescent fibroblasts. It is expressed in fetal liver and in the astrocytic process of primary astrocytic gliomas. SLC3A2 / MDU1 is also expressed in retinal endothelial cells and in the intestinal epithelial cell line Caco2-BBE. SLC3A2 / MDU1 is required for the function of light chain amino-acid transporters. It involved in sodium-independent, high-affinity transport of large neutral amino acids such as phenylalanine, tyrosine, leucine, arginine and tryptophan. SLC3A2 / MDU1 is involved in guiding and targeting of LAT1 and LAT2 to the plasma membrane. When associated with SLC7A6 or SLC7A7, SLC3A2 / MDU1 acts as an arginine/glutamine exchanger, following an antiport mechanism for amino acid transport, influencing arginine release in exchange for extracellular amino acids. SLC3A2 / MDU1 plays a role in nitric oxide synthesis in human umbilical vein endothelial cells (HUVECs) via transport of L-arginine. It is required for normal and neoplastic cell growth. When associated with SLC7A5/LAT1, SLC3A2 / MDU1 is also involved in the transport of L-DOPA across the blood-brain barrier, and that of thyroid hormones triiodothyronine (T3) and thyroxine (T4) across the cell membrane in tissues such as placenta.
Full Name
solute carrier family 3 (amino acid transporter heavy chain), member 2
References
  • Torrents D. et al., 1998, J Biol Chem. 273: 32437-45.
  • Pfeiffer R. et al., 1999, EMBO J. 18: 49-57.
  • Broeer A. et al., 2000, Biochem J. 349: 787-95.
  • Yanagida O. et al., 2001, Biochim Biophys Acta. 1514: 291-302.
  • Broeer A. et al., 2001, Biochem J. 355: 725-31.
  • Fort J. et al., 2007, J Biol Chem. 282: 31444-52.
  • Mayya V. et al., 2009, Sci Signal. 2: RA46-RA46.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait