Sino Biological - Official Website

pCMV3-untagged

pCMV3-untagged Physical Map

pCMV3-untagged Physical Map Comments for pCMV3-untagged:
• CMV promoter: bases 250-837
• Enhancer: bases 838-1385
• SV40 early promoter: bases 2297-2666
• Hygromycin ORF: bases 2684-3709
• pUC origin: bases 4352-5022
• Ampicillin ORF: bases 5167-6027

Cloning Sites for ORF Inserting

Cloning Sites for ORF Inserting

Expression Vector pCMV3-untagged Information Description

Vector Name pCMV3–untagged
Vector Size 6163bp
Vector Type Mammalian Expression Vector
Expression Method Constitutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward: T7(TAATACGACTCACTATAGGG); Reverse: BGH(TAGAAGGCACAGTCGAGG)