Quick Order

Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Mouse bFGF/FGF2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Mouse bFGF/FGF2 Gene Plasmid Map
Mouse bFGF Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Basic fibroblast growth factor (bFGF), also known as FGF2, is a member of the fibroblast growth factor (FGF) family. It is a highly specific chemotactic and mitogenic factor for many cell types, appears to be involved in remodeling damaged tissue, such as ulcer healing, vascular repair, traumatic brain injury (TBI). bFGF is a critical component of human embryonic stem cell culture medium. In addition, bFGF protein is a heparin-binding cationic protein involved in a variety of pathological conditions including angiogenesis and solid tumour growth. Thus, bFGF is regarded as a target for cancers chemopreventive and therapeutic strategies.

bFGF/FGF2 Protein & Antibody Products

  • Takayama S,et al. (2001) Periodontal regeneration by FGF-2 (bFGF) in primate models. J Dent Res. 80(12): 2075-9.
  • Niu YJ, et al. (2004) Therapeutic effect of bFGF on retina ischemia-reperfusion injury. Chin Med J (Engl). 117(2): 252-7.
  • Zhang Y,et al. (2004) Expression of aFGF, bFGF, and FGFR1 in ovarian epithelial neoplasm. Chin Med J (Engl). 117(4): 601-3.
  • Contact Us
    • Mouse bFGF Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.