Quick Order

Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Mouse bFGF/FGF2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Mouse bFGF/FGF2 Gene Plasmid Map
Mouse bFGF Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Basic fibroblast growth factor (bFGF), also known as FGF2, is a member of the fibroblast growth factor (FGF) family. It is a highly specific chemotactic and mitogenic factor for many cell types, appears to be involved in remodeling damaged tissue, such as ulcer healing, vascular repair, traumatic brain injury (TBI). bFGF is a critical component of human embryonic stem cell culture medium. In addition, bFGF protein is a heparin-binding cationic protein involved in a variety of pathological conditions including angiogenesis and solid tumour growth. Thus, bFGF is regarded as a target for cancers chemopreventive and therapeutic strategies.

bFGF/FGF2 Protein & Antibody Products

  • Takayama S,et al. (2001) Periodontal regeneration by FGF-2 (bFGF) in primate models. J Dent Res. 80(12): 2075-9.
  • Niu YJ, et al. (2004) Therapeutic effect of bFGF on retina ischemia-reperfusion injury. Chin Med J (Engl). 117(2): 252-7.
  • Zhang Y,et al. (2004) Expression of aFGF, bFGF, and FGFR1 in ovarian epithelial neoplasm. Chin Med J (Engl). 117(4): 601-3.
  • Contact Us
    • Mouse bFGF Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.