Quick Order

DatasheetReviewsRelated ProductsProtocols
Human bFGF/FGF2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human bFGF/FGF2 Gene Plasmid Map
Human bFGF Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Basic fibroblast growth factor (bFGF), also known as FGF2, is a member of the fibroblast growth factor (FGF) family. It is a highly specific chemotactic and mitogenic factor for many cell types, appears to be involved in remodeling damaged tissue, such as ulcer healing, vascular repair, traumatic brain injury (TBI). bFGF is a critical component of human embryonic stem cell culture medium. In addition, bFGF protein is a heparin-binding cationic protein involved in a variety of pathological conditions including angiogenesis and solid tumour growth. Thus, bFGF is regarded as a target for cancers chemopreventive and therapeutic strategies.

bFGF/FGF2 Protein & Antibody Products

  • Takayama S,et al. (2001) Periodontal regeneration by FGF-2 (bFGF) in primate models. J Dent Res. 80(12): 2075-9.
  • Niu YJ, et al. (2004) Therapeutic effect of bFGF on retina ischemia-reperfusion injury. Chin Med J (Engl). 117(2): 252-7.
  • Zhang Y,et al. (2004) Expression of aFGF, bFGF, and FGFR1 in ovarian epithelial neoplasm. Chin Med J (Engl). 117(4): 601-3.
  • Images
    • Human bFGF Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.