Quick Order

Human aFGF/FGF1 Gene ORF cDNA clone expression plasmid

  • Human aFGF / FGF1 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human aFGF/FGF1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in E. coli system. The translated amino acid sequence is identical with NP_000791.1.
Sequencing primers:( We provide with FGF1 qPCR primers for gene expression analysis, HP100110 )
Shipping_carrier:
Storage:
Human aFGF/FGF1 Gene Plasmid Map
Human aFGF / FGF1 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

aFGF, also known as FGF1 and HBGF-1, is a member of the fibroblast growth factor family. The biological activity of aFGF protein is exerted through binding to four high affinity cell surface receptors (FGFR1–4), which results in receptor dimerization and transphosphorylation in the tyrosine kinase domain. aFGF protein shows a wide range of endocrine-like activities. As a multiple function growth factor, this protein is involved in embryo development and tissue repair. Additionally, this protein is considered to function in several important physiological and pathological processes, such as embryonic development, morphogenesis, angiogenesis, wound healing and atheromatosis, carcinogenesis, development, and invasion of cancer.

References

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"