Quick Order

Text Size:AAA

Human aFGF/FGF1 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human aFGF/FGF1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:468bp
cDNA Description:Full length Clone DNA of Homo sapiens fibroblast growth factor 1 (acidic) with Flag tag.
Gene Synonym:FGF1, ECGF, ECGF-beta, ECGFA, ECGFB, FGF-alpha, FGFA, GLIO703, HBGF1
Restriction Site:KpnI + XhoI (5.5kb + 0.5kb)
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in E. coli system. The translated amino acid sequence is identical with NP_000791.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human aFGF/FGF1 Gene Plasmid Map
Human aFGF / FGF1 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

aFGF, also known as FGF1 and HBGF-1, is a member of the fibroblast growth factor family. The biological activity of aFGF protein is exerted through binding to four high affinity cell surface receptors (FGFR1–4), which results in receptor dimerization and transphosphorylation in the tyrosine kinase domain. aFGF protein shows a wide range of endocrine-like activities. As a multiple function growth factor, this protein is involved in embryo development and tissue repair. Additionally, this protein is considered to function in several important physiological and pathological processes, such as embryonic development, morphogenesis, angiogenesis, wound healing and atheromatosis, carcinogenesis, development, and invasion of cancer.


All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.