West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-His tag

Cat: VG40348-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All WNV Nonstructural protein 5 Reagents
CRO Services
Product recommended

All WNV Nonstructural protein 5 Reagents
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-His tag General Information
Gene
Species
WNV
NCBI Ref Seq
RefSeq ORF Size
2766 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence DQ211652.1 (7681..10395), corresponding to amino acid sequence YP_001527887.1.
Description
Full length Clone DNA of West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Restriction Sites
HindIII + NotI(6kb+2.77kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
WNV Nonstructural protein 5 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-His tag Validated Images
Human DHCR7 Gene Plasmid Map 5861
WNV Nonstructural protein 5 Background Information

WNV Nonstructural protein 5 cDNA ORF Clone, WNV, Related Products

Product Name Catalog#(PDF)
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid VG40348-G
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 natural ORF mammalian expression plasmid VG40348-UT
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, C-GFPSpark tag VG40348-ACG
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40348-ACGLN
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-GFPSpark tag VG40348-ANG
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40348-ACR
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40348-ANR
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged VG40348-CF
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-Flag tag VG40348-NF
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, C-His tag VG40348-CH
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, C-HA tag VG40348-CY
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-HA tag VG40348-NY
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, C-Myc tag VG40348-CM
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 ORF mammalian expression plasmid, N-Myc tag VG40348-NM
info info
添加购物车成功! 添加购物车失败!