West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, N-His tag

Cat: VG40346-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All WNV Nonstructural protein 1 Reagents
CRO Services
Product recommended

All WNV Nonstructural protein 1 Reagents
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, N-His tag General Information
Gene
Species
WNV
NCBI Ref Seq
RefSeq ORF Size
1152 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence DQ211652.1 (2470..3525), corresponding to amino acid sequence YP_001527881.1.
Description
Full length Clone DNA of West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Restriction Sites
KpnI + XbaI(6kb+1.15kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
WNV Nonstructural protein 1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, N-His tag Validated Images
Rhesus CD3d/CD3 delta Gene Plasmid Map 5615
WNV Nonstructural protein 1 Background Information
Full Name
interferon regulatory factor 3

WNV Nonstructural protein 1 cDNA ORF Clone, WNV, Related Products

Product Name Catalog#(PDF)
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid VG40346-G
West Nile virus (WNV) (stain Nea Santa-Greece-2010, lineage 2) WNV-NS1 partial Gene cDNA clone plasmid VG40521-G
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 natural ORF mammalian expression plasmid VG40346-UT
West Nile virus (WNV) (stain Nea Santa-Greece-2010, lineage 2) WNV-NS1 partial natural ORF mammalian expression plasmid VG40521-UT
West Nile virus (WNV) (stain Nea Santa-Greece-2010, lineage 2) WNV-NS1 partial Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag VG40521-ACGLN
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40346-ACGLN
West Nile virus (WNV) (stain Nea Santa-Greece-2010, lineage 2) WNV-NS1 partial ORF mammalian expression plasmid, C-GFPSpark tag VG40521-ACG
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, C-GFPSpark tag VG40346-ACG
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, N-GFPSpark tag VG40346-ANG
West Nile virus (WNV) (stain Nea Santa-Greece-2010, lineage 2) WNV-NS1 partial ORF mammalian expression plasmid, N-GFPSpark tag VG40521-ANG
West Nile virus (WNV) (stain Nea Santa-Greece-2010, lineage 2) WNV-NS1 partial ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40521-ACR
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40346-ACR
West Nile virus (WNV) (stain Nea Santa-Greece-2010, lineage 2) WNV-NS1 partial ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40521-ANR
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40346-ANR
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged VG40346-CF
West Nile virus (WNV) (stain Nea Santa-Greece-2010, lineage 2) WNV-NS1 partial ORF mammalian expression plasmid, C-Flag tag VG40521-CF
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, N-Flag tag VG40346-NF
West Nile virus (WNV) (stain Nea Santa-Greece-2010, lineage 2) WNV-NS1 partial ORF mammalian expression plasmid, N-Flag tag VG40521-NF
West Nile virus (WNV) (stain Nea Santa-Greece-2010, lineage 2) WNV-NS1 partial ORF mammalian expression plasmid, C-His tag VG40521-CH
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, C-His tag VG40346-CH
West Nile virus (WNV) (stain Nea Santa-Greece-2010, lineage 2) WNV-NS1 partial ORF mammalian expression plasmid, N-His tag VG40521-NH
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, C-HA tag VG40346-CY
West Nile virus (WNV) (stain Nea Santa-Greece-2010, lineage 2) WNV-NS1 partial ORF mammalian expression plasmid, C-HA tag VG40521-CY
West Nile virus (WNV) (stain Nea Santa-Greece-2010, lineage 2) WNV-NS1 partial ORF mammalian expression plasmid, N-HA tag VG40521-NY
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, N-HA tag VG40346-NY
West Nile virus (WNV) (stain Nea Santa-Greece-2010, lineage 2) WNV-NS1 partial ORF mammalian expression plasmid, C-Myc tag VG40521-CM
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, C-Myc tag VG40346-CM
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, N-Myc tag VG40346-NM
West Nile virus (WNV) (stain Nea Santa-Greece-2010, lineage 2) WNV-NS1 partial ORF mammalian expression plasmid, N-Myc tag VG40521-NM
info info
添加购物车成功! 添加购物车失败!