Text Size:AAA

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, C-His tag

  • West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
DatasheetReviewsRelated ProductsProtocols
WNV WNV-prM and E cDNA Clone Product Information
NCBI RefSeq:DQ211652.1
RefSeq ORF Size:2058bp
cDNA Description:Full length Clone DNA of West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E with C terminal His tag.
Gene Synonym:WNV-prM and E
Species:WNV
Vector:pCMV3-C-His
Plasmid:pCMV3-WNV-prM and E-His
Restriction Site:KpnI + XbaI (6kb + 2.11kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
WNV WNV-prM and E Gene Plasmid Map
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, C-His tag on other vectors
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, C-GFPSpark tagVG40345-ACG$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40345-ACR$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, N-GFPSpark tagVG40345-ANG$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40345-ANR$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, C-Flag tagVG40345-CF$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, C-His tagVG40345-CH$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, C-Myc tagVG40345-CM$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, C-HA tagVG40345-CY$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmidVG40345-G$115
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, N-Flag tagVG40345-NF$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, N-His tagVG40345-NH$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, N-Myc tagVG40345-NM$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E ORF mammalian expression plasmid, N-HA tagVG40345-NY$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E natural ORF mammalian expression plasmidVG40345-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40345-CH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"