Quick Order

Text Size:AAA

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
WNV WNV-NS3 cDNA Clone Product Information
NCBI RefSeq:DQ211652.1
RefSeq ORF Size:1857bp
cDNA Description:Full length Clone DNA of West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 with N terminal His tag.
Gene Synonym:WNV-NS3
Species:WNV
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence DQ211652.1 (4612..6468), corresponding to amino acid sequence YP_001527884.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-His tag on other vectors
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, C-GFPSpark tagVG40347-ACG$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40347-ACR$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-GFPSpark tagVG40347-ANG$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40347-ANR$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40347-CF$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, C-His tagVG40347-CH$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, C-Myc tagVG40347-CM$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, C-HA tagVG40347-CY$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid (Codon Optimized)VG40347-G$115
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-Flag tagVG40347-NF$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-His tagVG40347-NH$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-Myc tagVG40347-NM$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-HA tagVG40347-NY$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 natural ORF mammalian expression plasmidVG40347-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40347-NH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"