Text Size:AAA

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    WNV WNV-C cDNA Clone Product Information
    NCBI RefSeq:DQ211652.1
    RefSeq ORF Size:315bp
    cDNA Description:Full length Clone DNA of West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C with C terminal His tag.
    Gene Synonym:WNV-C
    Species:WNV
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:Identical with the Gene Bank Ref. ID sequence DQ211652.1 (97..411), corresponding to amino acid sequence YP_001527878.1.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-His tag on other vectors
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-GFPSpark tagVG40344-ACG$325
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40344-ACR$325
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-GFPSpark tagVG40344-ANG$325
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40344-ANR$325
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40344-CF$295
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-His tagVG40344-CH$295
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-Myc tagVG40344-CM$295
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-HA tagVG40344-CY$295
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmidVG40344-G$95
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-Flag tagVG40344-NF$295
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-His tagVG40344-NH$295
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-Myc tagVG40344-NM$295
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-HA tagVG40344-NY$295
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C natural ORF mammalian expression plasmidVG40344-UT$295
     Learn more about expression Vectors
    Product nameProduct name
    Size / Price
    Catalog: VG40344-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"