Quick Order

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-HA tag

    DatasheetReviewsRelated ProductsProtocols
    WNV WNV-C cDNA Clone Product Information
    NCBI RefSeq:DQ211652.1
    RefSeq ORF Size:315bp
    cDNA Description:Full length Clone DNA of West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C with C terminal HA tag.
    Gene Synonym:WNV-C
    Species:WNV
    Vector:pCMV3-C-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:Identical with the Gene Bank Ref. ID sequence DQ211652.1 (97..411), corresponding to amino acid sequence YP_001527878.1.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-HA tag on other vectors
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-GFPSpark tagVG40344-ACG$325
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40344-ACR$325
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-GFPSpark tagVG40344-ANG$325
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40344-ANR$325
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40344-CF$295
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-His tagVG40344-CH$295
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-Myc tagVG40344-CM$295
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, C-HA tagVG40344-CY$295
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmidVG40344-G$95
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-Flag tagVG40344-NF$295
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-His tagVG40344-NH$295
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-Myc tagVG40344-NM$295
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C ORF mammalian expression plasmid, N-HA tagVG40344-NY$295
    West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) C natural ORF mammalian expression plasmidVG40344-UT$295
     Learn more about expression Vectors
    Product nameProduct name
    Size / Price
    Catalog: VG40344-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"