WIF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10106-M-F
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All WIF1 Reagents
CRO Services

All WIF1 Reagents
WIF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1139 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 219 A/G not causing the amino acid variation.
Description
Full length Clone DNA of Human WNT inhibitory factor 1 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI (5.5kb + 1.17kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
WIF1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

WIF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human G-CSF/CSF3 Gene Plasmid Map 7153
WIF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
WIF-1 cDNA ORF Clone, Human
WIF1 Background Information

WIF1, also known as WIF-1 and wnt inhibitory factor 1, is a secreted protein which binds WNT proteins and inhibits their activities. It contains a WNT inhibitory factor (WIF) domain and 5 epidermal growth factor (EGF)-like domains. WNT proteins are extracellular signaling molecules involved in the control of embryonic development. WIF1 may be involved in mesoderm segmentation and can be detected in fish, amphibia and mammals. WIF-1 is a recurrent target in human salivary gland oncogenesis. Downregulation of WIF1 takes part in the development and progression of pleomorphic adenomas. WIF1 also is a tumor suppressor, and has been found to be epigenetically silenced in various cancers, specifically in nonfunctioning pituitary tumors. WIF1 are expected to have molecular function (protein tyrosine kinase activity) and to localize in various compartments (extracellular space, extracellular region).

Full Name
WNT inhibitory factor 1
References
  • Shepelev MV, et al. (2006) WIF1: perspectives of application in oncology. Mol Gen Mikrobiol Virusol. (4): 3-7.
  • Lin YC, et al. (2006) Wnt signaling activation and WIF-1 silencing in nasopharyngeal cancer cell lines. Biochem Biophys Res Commun. 341(2):635-40.
  • Queimado L, et al. (2007) WIF1, an inhibitor of the Wnt pathway, is rearranged in salivary gland tumors. Genes Chromosomes Cancer. 46(3):215-25.
  • WIF1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    WIF1 cDNA ORF Clone in Cloning Vector, Rat RG81506-G

    WIF1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    WIF1 cDNA ORF Clone in Cloning Vector, Mouse MG50984-G
    WIF1 cDNA ORF Clone, Mouse, untagged MG50984-UT
    WIF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50984-ACGLN
    WIF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50984-ACG
    WIF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50984-ACR
    WIF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50984-CF
    WIF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50984-NF
    WIF1 cDNA ORF Clone, Mouse, C-His tag MG50984-CH
    WIF1 cDNA ORF Clone, Mouse, N-His tag MG50984-NH
    WIF1 cDNA ORF Clone, Mouse, C-HA tag MG50984-CY
    WIF1 cDNA ORF Clone, Mouse, N-HA tag MG50984-NY
    WIF1 cDNA ORF Clone, Mouse, C-Myc tag MG50984-CM
    WIF1 cDNA ORF Clone, Mouse, N-Myc tag MG50984-NM
    WIF1 qPCR Primer Pairs, Mouse MP200950

    WIF1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    WIF1 cDNA ORF Clone in Cloning Vector, Human HG10106-U
    WIF1 cDNA ORF Clone, Human, untagged HG10106-UT
    WIF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10106-ACGLN
    WIF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10106-ACG
    WIF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10106-ACR
    WIF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10106-CF
    WIF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10106-NF
    WIF1 cDNA ORF Clone, Human, C-His tag HG10106-CH
    WIF1 cDNA ORF Clone, Human, N-His tag HG10106-NH
    WIF1 cDNA ORF Clone, Human, C-HA tag HG10106-CY
    WIF1 cDNA ORF Clone, Human, N-HA tag HG10106-NY
    WIF1 cDNA ORF Clone, Human, C-Myc tag HG10106-CM
    WIF1 cDNA ORF Clone, Human, N-Myc tag HG10106-NM
    WIF1 qPCR Primer Pairs, Human HP104852
    info info
    添加购物车成功! 添加购物车失败!