After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human WIF1 / WIF-1 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human WIF1 cDNA Clone Product Information
NCBI RefSeq:NM_007191.4
RefSeq ORF Size:1139bp
cDNA Description:Full length Clone DNA of Homo sapiens WNT inhibitory factor 1 with Flag tag.
Gene Synonym:WIF-1
Restriction Site:KpnI + XhoI (5.5kb + 1.17kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 219 A/G not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human WIF1 Gene Plasmid Map
Human WIF1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

WIF1, also known as WIF-1 and wnt inhibitory factor 1, is a secreted protein which binds WNT proteins and inhibits their activities. It contains a WNT inhibitory factor (WIF) domain and 5 epidermal growth factor (EGF)-like domains. WNT proteins are extracellular signaling molecules involved in the control of embryonic development. WIF1 may be involved in mesoderm segmentation and can be detected in fish, amphibia and mammals. WIF-1 is a recurrent target in human salivary gland oncogenesis. Downregulation of WIF1 takes part in the development and progression of pleomorphic adenomas. WIF1 also is a tumor suppressor, and has been found to be epigenetically silenced in various cancers, specifically in nonfunctioning pituitary tumors. WIF1 are expected to have molecular function (protein tyrosine kinase activity) and to localize in various compartments (extracellular space, extracellular region).

  • Shepelev MV, et al. (2006) WIF1: perspectives of application in oncology. Mol Gen Mikrobiol Virusol. (4): 3-7.
  • Lin YC, et al. (2006) Wnt signaling activation and WIF-1 silencing in nasopharyngeal cancer cell lines. Biochem Biophys Res Commun. 341(2):635-40.
  • Queimado L, et al. (2007) WIF1, an inhibitor of the Wnt pathway, is rearranged in salivary gland tumors. Genes Chromosomes Cancer. 46(3):215-25.
  • Size / Price
    Catalog: HG10106-M-F
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    • Human WIF1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.