Quick Order

Human DUSP3/VHR Gene ORF cDNA clone expression plasmid

  • Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human DUSP3/VHR cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with DUSP3 qPCR primers for gene expression analysis, HP100189 )
Promoter:
Application:
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human DUSP3/VHR Gene Plasmid Map
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Vaccinia H1-related phosphatase (VHR) is classified as a dual-specificity phosphatase (DUSP), and the other name is dual-specificity phosphatase 3 (DUSP3). DUSPs are a heterogeneous group of protein phosphatases that can dephosphorylate both phosphotyrosine and phosphoserine/phosphothreonine residues within the one substrate. Unlike typical DUSPs, VHR lacks mitogen-activated protein kinase (MAPK)-binding domain, and shows poor activity against MAPKs. VHR often act on bisphosphorylated protein substrates, it displays a strong preference for dephosphorylating phosphotyrosine residues over phosphothreonine residues. VHR has been identified as a novel regulator of extracellular regulated kinases (ERKs). VHR is responsible for the rapid inactivation of ERK following stimulation and for its repression in quiescent cells. VHR is a negative regulator of the Erk and Jnk pathways in T cells and, therefore, may play a role in aspects of T lymphocyte physiology that depend on these kinases.

References
  • Todd J.L, et al. (1999) Extracellular regulated kinases (ERK) 1 and ERK2 are authentic substrates for the dual-specificity protein-tyrosine phosphatase VHR. A novel role in down-regulating the ERK pathway. J. Biol. Chem. 274: 13271-80.
  • Alonso A, et al. (2001) Inhibitory role for dual specificity phosphatase VHR in T cell antigen receptor and CD28-induced Erk and Jnk activation. J Biol Chem. 276(7): 4766-71.
  • Schumacher MA, et al. (2002) Structural basis for the recognition of a bisphosphorylated MAP kinase peptide by human VHR protein Phosphatase. Biochemistry. 41(9): 3009-17.
  • Patterson KI, et al. (2009) Dual-specificity phosphatases: critical regulators with diverse cellular targets. Biochem J. 2009 Mar 15;418(3): 475-89.
  • Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"