After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human DUSP3/VHR Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human DUSP3/VHR cDNA Clone Product Information
NCBI RefSeq:NM_004090.3
RefSeq ORF Size:558bp
cDNA Description:Full length Clone DNA of Homo sapiens dual specificity phosphatase 3 with Flag tag.
Gene Synonym:DUSP3, VHR
Restriction Site:KpnI + XhoI (5.5kb + 0.59kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human DUSP3/VHR Gene Plasmid Map
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Vaccinia H1-related phosphatase (VHR) is classified as a dual-specificity phosphatase (DUSP), and the other name is dual-specificity phosphatase 3 (DUSP3). DUSPs are a heterogeneous group of protein phosphatases that can dephosphorylate both phosphotyrosine and phosphoserine/phosphothreonine residues within the one substrate. Unlike typical DUSPs, VHR lacks mitogen-activated protein kinase (MAPK)-binding domain, and shows poor activity against MAPKs. VHR often act on bisphosphorylated protein substrates, it displays a strong preference for dephosphorylating phosphotyrosine residues over phosphothreonine residues. VHR has been identified as a novel regulator of extracellular regulated kinases (ERKs). VHR is responsible for the rapid inactivation of ERK following stimulation and for its repression in quiescent cells. VHR is a negative regulator of the Erk and Jnk pathways in T cells and, therefore, may play a role in aspects of T lymphocyte physiology that depend on these kinases.

  • Todd J.L, et al. (1999) Extracellular regulated kinases (ERK) 1 and ERK2 are authentic substrates for the dual-specificity protein-tyrosine phosphatase VHR. A novel role in down-regulating the ERK pathway. J. Biol. Chem. 274: 13271-80.
  • Alonso A, et al. (2001) Inhibitory role for dual specificity phosphatase VHR in T cell antigen receptor and CD28-induced Erk and Jnk activation. J Biol Chem. 276(7): 4766-71.
  • Schumacher MA, et al. (2002) Structural basis for the recognition of a bisphosphorylated MAP kinase peptide by human VHR protein Phosphatase. Biochemistry. 41(9): 3009-17.
  • Patterson KI, et al. (2009) Dual-specificity phosphatases: critical regulators with diverse cellular targets. Biochem J. 2009 Mar 15;418(3): 475-89.
  • Contact Us
    • Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.